View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3221_high_6 (Length: 230)
Name: NF3221_high_6
Description: NF3221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3221_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 39082163 - 39081950
Alignment:
| Q |
1 |
attgttttgaaagagttcatgagaagatccatctttagtttgatcaccatgtcatgcttgaaaatgatccataaaggctcttgttggataacagcatgtc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39082163 |
attgttttgaaagaattcatgagaagatccatctttagtttgatcaccatgtcatgcttgaaaatgatccataaaggctcttgttggataacagcatgtc |
39082064 |
T |
 |
| Q |
101 |
ttaatgttcctggcttaggattcacagggtcatcacttgagtcaatgaccatgtaatattttccatctttacctccaattgcacgtctaccgaacccaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39082063 |
ttaatgttcctggcttaggattcacagggtcatcacttgagtcaatgaccatgtaatattttccatctttacctccaattgcacgtctaccgaacccaat |
39081964 |
T |
 |
| Q |
201 |
agcacattctgcta |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39081963 |
agcacattctgcta |
39081950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 127
Target Start/End: Complemental strand, 39075669 - 39075588
Alignment:
| Q |
46 |
accatgtcatgcttgaaaatgatccataaaggctcttgttggataacagcatgtcttaatgttcctggcttaggattcacag |
127 |
Q |
| |
|
||||||||| ||||||| || ||||| || || |||| ||| |||||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
39075669 |
accatgtcacgcttgaagattatccacaatggttcttcttgaataacaccatatcttaatgttcctggctttggattcacag |
39075588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University