View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_high_101 (Length: 254)
Name: NF3223_high_101
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_high_101 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 106 - 237
Target Start/End: Original strand, 30319853 - 30319985
Alignment:
| Q |
106 |
aaatagaaagtctt-gtattatttacccattgctgatatgtaatttactaactagtgcaacttgttcactttagttttcattgatttgtttaagataaat |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30319853 |
aaatagaaagtctttgtattatttacccattgctgatatgtaatttactaactagtgcaacttgttcactttagttttcattgatttgtttaagataaat |
30319952 |
T |
 |
| Q |
205 |
tgcaaatgttgaagaattctacgtaggtgttca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30319953 |
tgcaaatgttgaagaattctacgtaggtgttca |
30319985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30319734 - 30319782
Alignment:
| Q |
1 |
ttgcatagatataattcttaaaaactagaacactttcctgcctaaccat |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30319734 |
ttgcatagatataattcttaaaaactagaacactttccttcctaaccat |
30319782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University