View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_high_103 (Length: 251)
Name: NF3223_high_103
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_high_103 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 87 - 230
Target Start/End: Complemental strand, 14225635 - 14225491
Alignment:
| Q |
87 |
tacttgattacaagtttgaattttggtatgcaatgctcttgaaaatccaaatcttatgatacgtatcaggttatgat-aaaaaataaaccagcacagtca |
185 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
14225635 |
tacttgattacaaatttgaattttggtatgcaatgctcttgaaattccaaatcttatgatacttatcaggttatcataaaaaaataaaccagcacggtca |
14225536 |
T |
 |
| Q |
186 |
aacagctcgaatagtgagaggtttaagagtgatgtggtggtcgtg |
230 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14225535 |
aacagctcgaatggtgagaggtttaagagtgatgtggtggtcgtg |
14225491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University