View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3223_high_103 (Length: 251)

Name: NF3223_high_103
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3223_high_103
NF3223_high_103
[»] chr8 (1 HSPs)
chr8 (87-230)||(14225491-14225635)


Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 87 - 230
Target Start/End: Complemental strand, 14225635 - 14225491
Alignment:
87 tacttgattacaagtttgaattttggtatgcaatgctcttgaaaatccaaatcttatgatacgtatcaggttatgat-aaaaaataaaccagcacagtca 185  Q
    ||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || ||||||||||||||||| ||||    
14225635 tacttgattacaaatttgaattttggtatgcaatgctcttgaaattccaaatcttatgatacttatcaggttatcataaaaaaataaaccagcacggtca 14225536  T
186 aacagctcgaatagtgagaggtttaagagtgatgtggtggtcgtg 230  Q
    |||||||||||| ||||||||||||||||||||||||||||||||    
14225535 aacagctcgaatggtgagaggtttaagagtgatgtggtggtcgtg 14225491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University