View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3223_high_113 (Length: 249)

Name: NF3223_high_113
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3223_high_113
NF3223_high_113
[»] chr2 (1 HSPs)
chr2 (1-249)||(2535635-2535881)


Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 2535635 - 2535881
Alignment:
1 ggaagaaattaagatggttttccaaaaattatttggaaacgcactagttgatttgaactttgaagttggtgcatatgcttggaatattaacaacgtaaag 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
2535635 ggaagaaataaagatggttttccaaaaattatttggaaacgcactagttgatttgaactttgaagtttgtgcatatgcttggaatattaacaacgtaaag 2535734  T
101 aaagcataggattggaatttaggtttgaaagaaacaaccaaggcagcttaaattattattatgcaaattatggtnnnnnnnnnngttgcagcttatgaat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |          ||||||| ||||||||    
2535735 aaagcataggattggaatttaggtttgaaagaaacaaccaaggcagcttaaattattattatgcaaattatgct--aaaaaaaagttgcaggttatgaat 2535832  T
201 tatgcttaccaaattaaaggcagaggagagatgaagacagctgaagaag 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
2535833 tatgcttaccaaattaaaggcagaggagagatgaagacagctgaagaag 2535881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University