View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3223_high_134 (Length: 237)

Name: NF3223_high_134
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3223_high_134
NF3223_high_134
[»] chr1 (1 HSPs)
chr1 (159-220)||(47819922-47819983)


Alignment Details
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 159 - 220
Target Start/End: Complemental strand, 47819983 - 47819922
Alignment:
159 aattgaatcaaccttttgagttgatctatctccatataaattaagtcataataattaattta 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47819983 aattgaatcaaccttttgagttgatctatctccatataaattaagtcataataattaattta 47819922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University