View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3223_high_156 (Length: 220)

Name: NF3223_high_156
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3223_high_156
NF3223_high_156
[»] chr2 (1 HSPs)
chr2 (18-201)||(26203699-26203882)


Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 26203882 - 26203699
Alignment:
18 gaaccacccactgatatgaagtgaagaggttgggtgcgtgtgggtcccacttaatctctttcttaac-ccccactttccattttatagactcaccacatc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||    
26203882 gaaccacccactgatatgaagtgaagaggttgggtgcgtgtgggtcccacttaatctctttcttaaccccccactttccattttatacactcaccacatc 26203783  T
117 accgacgcataccaaacactcaaatnnnnnnntcaattcaactccaactaactccaccagccaccaccatgacgacggcgatctc 201  Q
    ||||||||||||||| |||||||||       ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
26203782 accgacgcataccaagcactcaaataaaaaaatcaattcaact-caactaactccaccagccaccaccatgacgacggcgatctc 26203699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University