View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_high_156 (Length: 220)
Name: NF3223_high_156
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_high_156 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 26203882 - 26203699
Alignment:
| Q |
18 |
gaaccacccactgatatgaagtgaagaggttgggtgcgtgtgggtcccacttaatctctttcttaac-ccccactttccattttatagactcaccacatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
26203882 |
gaaccacccactgatatgaagtgaagaggttgggtgcgtgtgggtcccacttaatctctttcttaaccccccactttccattttatacactcaccacatc |
26203783 |
T |
|
| Q |
117 |
accgacgcataccaaacactcaaatnnnnnnntcaattcaactccaactaactccaccagccaccaccatgacgacggcgatctc |
201 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203782 |
accgacgcataccaagcactcaaataaaaaaatcaattcaact-caactaactccaccagccaccaccatgacgacggcgatctc |
26203699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University