View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3223_high_159 (Length: 215)

Name: NF3223_high_159
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3223_high_159
NF3223_high_159
[»] chr6 (1 HSPs)
chr6 (186-215)||(34624692-34624721)


Alignment Details
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 186 - 215
Target Start/End: Original strand, 34624692 - 34624721
Alignment:
186 tagagagataacactaaaatgaaacatatt 215  Q
    ||||||||||||||||||||||||||||||    
34624692 tagagagataacactaaaatgaaacatatt 34624721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University