View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_high_20 (Length: 448)
Name: NF3223_high_20
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 7172985 - 7173225
Alignment:
| Q |
1 |
tgtggttgacgtttggtctgggaaccatccattttacctaggtaacaggtctgctcttatggtgagtgatgatcaggtggagaagtttcgtaagaagttc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7172985 |
tgtggttgatgtttggtctgggaaccatccattttacctaggtaacaggtctgctcttatggtgagtgatgatcaggtggagaagtttcgtaagaagttc |
7173084 |
T |
|
| Q |
101 |
ggtgaattgtcacagattatggagattcctgtgcttaaaggtgagattgttattccttctagacgtaaagggattaaaagtggtcgagtg-agaagaagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
7173085 |
ggtgaattgtcacagattatggagattcctgtgcttaaaggtgagattgttattccttctagacgtaaagggattaaaagtggtggagggaagaagaagt |
7173184 |
T |
|
| Q |
200 |
gagttatttgtgttggaattgtaatttgattgtatggtgtt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7173185 |
gagttatttgtgttggaattgtaatttgattgtatggtgtt |
7173225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 324 - 398
Target Start/End: Original strand, 7173309 - 7173383
Alignment:
| Q |
324 |
gattgttgcgagattggcataatcactgtgagccaatgtgattttggataaccaaaactacattttggagcttcg |
398 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7173309 |
gattgttgcgagattggtataatcactgtgagccaatgtgattttggataaccaaaactacattttggagcttcg |
7173383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University