View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_high_54 (Length: 351)
Name: NF3223_high_54
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_high_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 25 - 331
Target Start/End: Complemental strand, 33993955 - 33993651
Alignment:
| Q |
25 |
ataaatgactaactcggcatgaaaaatggtaataaaggattcatgatgcagttttgccaaacaaatagctttattcgaatcaagtttgcttctctaagca |
124 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33993955 |
ataaatgactaactcgacatgaaaaatggtaataaaggattcatgatgcagttttgccaaacaaatagctttattcgaatcaagtttgcttctctaagca |
33993856 |
T |
 |
| Q |
125 |
catgccaatcacttcacgtcatttatttcccacaataataaaagttccacaaacattgtcaagaacaagcaagnnnnnnnnnnnnnnntaatagtccaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33993855 |
catgccaatcacttcacgtcatttatttcccacaataataaaagttccacaaacattgtcaagaacaagcaag--acacacacacacataatagtccaaa |
33993758 |
T |
 |
| Q |
225 |
caaagtaacatttaaatgccttgttccatcatggctctgatcctcattggaagaccataaagctttataaacccaacagcatcagcatgattatatatct |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33993757 |
caaagtaacatttaaatgccttgttccatcatggctctgatcctcattggaagaccataaagctttataaacccaacagcatcagcatgattatatatct |
33993658 |
T |
 |
| Q |
325 |
ccccact |
331 |
Q |
| |
|
||||||| |
|
|
| T |
33993657 |
ccccact |
33993651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University