View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_high_67 (Length: 329)
Name: NF3223_high_67
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_high_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 4776055 - 4776367
Alignment:
| Q |
1 |
gagatgaagtccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagcttgcatttgttatgctagt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776055 |
gagatggagtccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagcttgcatttgttatgctagt |
4776154 |
T |
 |
| Q |
101 |
ttattcactggaaatgctatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagtatactgcgaaattccttactgtcacagtatgtggagtcgg |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776155 |
ttattcactggaaatgcaatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagcatactgcgaaattccttactgtcacagtatgtggagtcgg |
4776254 |
T |
 |
| Q |
201 |
gtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtttgcagtcgcccatgtttgctcgaaggagaatatctcttatgtaatgatcttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4776255 |
gtttaggttgtgagcagaatgaggtggccatgggagtagacacaggtttgcagtcgcccatgtttgctcgaaggagaatatctcttatgtgatgatcttg |
4776354 |
T |
 |
| Q |
301 |
tgtaagaaataag |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4776355 |
tgtaagaaataag |
4776367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University