View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_high_81 (Length: 275)
Name: NF3223_high_81
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_high_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 39 - 248
Target Start/End: Complemental strand, 30553314 - 30553098
Alignment:
| Q |
39 |
gaattgttaacgttcatccttgaagacgatgcctgaaacctnnnnnnnnnnnnttgattattcgaagtttgttttcttgatttttctaatctttaatcct |
138 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||| | |||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30553314 |
gaatcgttaacgttcatccttaaagacgatgcctgaaacctaaaaaataaaaatcgattattccaagtttgttttcttggtttttctaatctttaatcct |
30553215 |
T |
 |
| Q |
139 |
gaaatcaatttcactcatcataatatcggtttcttaactcagaaacctcttaaaacat-------tgcagaatcacacaaaaataaattaacatcaaaca |
231 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30553214 |
gaaattaatttcactcatcctaatatcggtttcttaactcagaaacctcttaaaacattgcacattgcagaatcacacaaaaataatttaacatcaaaca |
30553115 |
T |
 |
| Q |
232 |
taacaaataaattaatt |
248 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
30553114 |
taacaaataaattaatt |
30553098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University