View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_100 (Length: 255)
Name: NF3223_low_100
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_100 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 46307582 - 46307824
Alignment:
| Q |
13 |
catagggtatggtgcctctagtactgtgtacaagtgtgtgttgaaaaattcccgacccattgcagtcaagcgattgtacaatcagcatcctcacaattta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46307582 |
catagggtatggtgcctctagtactgtgtacaagtgtgtgttgaaaaattcccgaccgattgcagtcaagcgattgtacaatcagcatcctcacaattta |
46307681 |
T |
|
| Q |
113 |
agagaatttgaaacggagcttgaaacaattggcagcattagacatagaaatcttgtcacattgcatggctatgcacttactccttatggaaatctccttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46307682 |
agagaatttgaaacggagcttgaaacaattggcagcattagacatagaaatcttgtcacattgcatggctatgcacttactccttttggaaatctccttt |
46307781 |
T |
|
| Q |
213 |
tttatgagtacatggcaaatggctcgctctgggatcttctaca |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46307782 |
tttatgagtacatggcaaatggctcgctctgggatcttctaca |
46307824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University