View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_113 (Length: 249)
Name: NF3223_low_113
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_113 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 5034768 - 5035008
Alignment:
| Q |
11 |
cacagaatctaagtgataaggaggaaaaataagtgaactcactatgtcaaaactagtcaccctcttcaccttagctcttctattaagcttgagtttaacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5034768 |
cacagaatctaagtgataaggaggaaaaataagtgaactcactatgtcaaaactagtcaccctcttcaccttagctcttctattaagcttgagtttaacc |
5034867 |
T |
|
| Q |
111 |
tctgcctctcgtcctaattttgtatttaaaggtgtctcttcactacacgaggtacgtttttccttcttaattgggtaattagtg--aaagcttatacaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
5034868 |
tctgcctctcgtcctaattttgtatttaaaggtgtctcttcactacacgaggtacgtttttccttcttaattgggtaattagtgaaaaatcttatacaag |
5034967 |
T |
|
| Q |
209 |
atgttaagttattctttttgttgtgttctatttttgttttt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5034968 |
atgttaagttattctttttgttgtgttctatttttgttttt |
5035008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University