View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_128 (Length: 241)
Name: NF3223_low_128
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_128 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 45
Target Start/End: Original strand, 13710395 - 13710439
Alignment:
| Q |
3 |
aaaatgttgatttttacttataataatgatcag--ggtgtatatt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13710395 |
aaaatgttgatttttacttataataatgatcagatggtgtatatt |
13710439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 32
Target Start/End: Original strand, 29419892 - 29419921
Alignment:
| Q |
3 |
aaaatgttgatttttacttataataatgat |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29419892 |
aaaatgttgatttttacttataataatgat |
29419921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 31
Target Start/End: Original strand, 35511876 - 35511904
Alignment:
| Q |
3 |
aaaatgttgatttttacttataataatga |
31 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35511876 |
aaaatgttgatttttacttataataatga |
35511904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 233
Target Start/End: Complemental strand, 13537256 - 13537200
Alignment:
| Q |
178 |
tgatagttcaaattattttaactaaattt-agtgttaatttaatcattcatctcatt |
233 |
Q |
| |
|
||||| || |||| ||||||||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
13537256 |
tgatatttgaaatgattttaactaaattttagtgttaatttgatcattcatttcatt |
13537200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University