View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_129 (Length: 240)
Name: NF3223_low_129
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_129 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 46873530 - 46873306
Alignment:
| Q |
1 |
aaggatggaatcattttccattcaaaacttgctctgtcaaatcaaacatgaaacataatagacaacgcaaccacaaaatgacacacattcaaatcattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873530 |
aaggatggaatcattttccattcaaaacttgctctgtcaaatcaaacatgaaacataatagacaacgcaaccacaaaatgacacacattcaaatcattta |
46873431 |
T |
 |
| Q |
101 |
attaatcgctgtaatttgcacatcatatcacataaaatgacattctacacagcatctagaaaattnnnnnnnnnnnntattttatatgattgaacaatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46873430 |
attaatcgctgtaatttgcacatcatatcacataaaatgacattctacacagcatctagaaaatt-aaaaaaaaacatattttatatgattgaacaatat |
46873332 |
T |
 |
| Q |
201 |
aaaacagtagaattatatgataaaac |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46873331 |
aaaacagtagaattatatgataaaac |
46873306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 46890766 - 46890718
Alignment:
| Q |
178 |
tattttatatgattgaacaatataaaacagtagaattatatgataaaac |
226 |
Q |
| |
|
|||||||||| ||| ||||| ||||| || ||||||||||||||||||| |
|
|
| T |
46890766 |
tattttatataattaaacaaaataaagcaatagaattatatgataaaac |
46890718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University