View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_130 (Length: 238)
Name: NF3223_low_130
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_130 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 67 - 238
Target Start/End: Complemental strand, 5035344 - 5035173
Alignment:
| Q |
67 |
attcaacaaaaactcaagaaaattaagcatattttttatacatgaaacaaaaatttatatattgatcatatattgctttattgcattattatgtcgcttc |
166 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5035344 |
attcaacaaaaactcaacaaaattaagcatattttttatacatgaaacaaaaatttatatattgatcatatattgctttattgcattattatgttgcttc |
5035245 |
T |
 |
| Q |
167 |
cattccaaagacattaatttttgggtttatgctgagtgtagatataatcgagatgtgcagctagagtccttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035244 |
cattccaaagacattaatttttgggtttatgctgagtgtagatataatcgagatgtgcagctagagtccttc |
5035173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 238
Target Start/End: Complemental strand, 4970743 - 4970706
Alignment:
| Q |
201 |
agtgtagatataatcgagatgtgcagctagagtccttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4970743 |
agtgtagatataatcgagatgtgcagctagagtccttc |
4970706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University