View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3223_low_130 (Length: 238)

Name: NF3223_low_130
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3223_low_130
NF3223_low_130
[»] chr1 (2 HSPs)
chr1 (67-238)||(5035173-5035344)
chr1 (201-238)||(4970706-4970743)


Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 67 - 238
Target Start/End: Complemental strand, 5035344 - 5035173
Alignment:
Q  67 attcaacaaaaactcaagaaaattaagcatattttttatacatgaaacaaaaatttatatattgatcatatattgctttattgcattattatgtcgcttc 166  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  5035344 attcaacaaaaactcaacaaaattaagcatattttttatacatgaaacaaaaatttatatattgatcatatattgctttattgcattattatgttgcttc 5035245  T
Q  167 cattccaaagacattaatttttgggtttatgctgagtgtagatataatcgagatgtgcagctagagtccttc 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5035244 cattccaaagacattaatttttgggtttatgctgagtgtagatataatcgagatgtgcagctagagtccttc 5035173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 238
Target Start/End: Complemental strand, 4970743 - 4970706
Alignment:
Q  201 agtgtagatataatcgagatgtgcagctagagtccttc 238  Q
    ||||||||||||||||||||||||||||||||||||||    
T  4970743 agtgtagatataatcgagatgtgcagctagagtccttc 4970706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University