View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_131 (Length: 238)
Name: NF3223_low_131
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_131 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7954579 - 7954363
Alignment:
| Q |
1 |
ccttgttctagaatcttattatgttccatgacaccataccatggtatcaaacttggatgaattggaacgaatctatgaacaaccaaccatactcatatcg |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7954579 |
ccttgttctagaaacttattatgttccatgacaccat-----ggtatcaaacttggatgaattggaacgaatctatgaacaaccaaccatactcatatcg |
7954485 |
T |
 |
| Q |
101 |
ccaaacaattcagctcacaagctcaatatattgcttcaattagtaccacttagatgaaatgcatatttagatcatatggaagagcatacatttaaactgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7954484 |
ccaaacaattcagctcacaagctcaatatattgcttcaattagtaccacttagatgaaatgcatatttagatcatatggaagagcatacatttaaactgt |
7954385 |
T |
 |
| Q |
201 |
ttggtggttggaggccaacagt |
222 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
7954384 |
ttggtggttagaggccaacagt |
7954363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 85 - 149
Target Start/End: Original strand, 26135399 - 26135463
Alignment:
| Q |
85 |
aaccatactcatatcgccaaacaattcagctcacaagctcaatatattgcttcaattagtaccac |
149 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
26135399 |
aaccatacttatacagccatacaattcagctcacaagctcagtatattgctccaattagtaccac |
26135463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University