View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_133 (Length: 237)
Name: NF3223_low_133
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_133 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 45128801 - 45128586
Alignment:
| Q |
1 |
tgcttttccatcacttcactactggaatttgaagcactaacacgacaaacaacgacacacgtcgataccaacaataataatttgacagaattgaatgtaa |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45128801 |
tgcttttccatcacttcacttctggaatttgaagcgctaacacgacaat----gacacacgtcgataccaa---taataatttgacagaattgaatgtaa |
45128709 |
T |
 |
| Q |
101 |
tcacttgtgtctgtcgatgttagacatcgacatcaacacgtgttagctttcaagtttagctaattcacttagattgttttgttgtgtccttgtagcaagc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45128708 |
tcacttgtgtctgttgatgttagacatcgacatcaacacgtgttagctttcaagtttagctaattcacttagattgttttgttgtgtccttgtagcaagc |
45128609 |
T |
 |
| Q |
201 |
aaatgaaatgatagatgtatgtg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45128608 |
aaatgaaatgatagatgtatgtg |
45128586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University