View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_140 (Length: 236)
Name: NF3223_low_140
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_140 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 673039 - 672839
Alignment:
| Q |
20 |
tatgtataatgggagaacattctaaagaagaatacaattatgaaacttattcatcactttcgttcattttagaatggctatacatgcatgcatgaaactt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
673039 |
tatgtataatgggagaacattctaaagaagaatacaattatgaaacttattcatcactttcgttcattttagaatggctatacatgcatgcatgaaactt |
672940 |
T |
|
| Q |
120 |
ttttggtcttcgatttcaaacacaattttgcaatcatataaacttgtcaaaagtaagtatcaaaaagtagctaaaattttggtctagtcaaattctttct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
672939 |
ttttggtcttcgatttcaaacacaattttgcaatcatataaacttgtcaaaagtaagtatcaaaaagtagctaaaattttggtctagtcaaattctttct |
672840 |
T |
|
| Q |
220 |
t |
220 |
Q |
| |
|
| |
|
|
| T |
672839 |
t |
672839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University