View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_143 (Length: 235)
Name: NF3223_low_143
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_143 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 47774569 - 47774781
Alignment:
| Q |
19 |
gatatagaacaaagtgaatcaattcaacaatattctttataaggacttcaattaaatgaatctttttaatatgtttactcttcttcgttcacacattttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47774569 |
gatatagaacaaagtgaatcaattcaacaatattctttataaggacttcaattaaatgaatctttttaatatgtttactcttcttcgttcacacattttc |
47774668 |
T |
 |
| Q |
119 |
tagaaaaatttacgtaatgtcactcattacaagttattcaaatac-----------aagttcttatactctaggttccttaaaaagaatatgcaccttct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47774669 |
aagaaaaatttacgtaatgtcactcattacaagttattcaaatacacttaataatgaagttcttatactctaggttccttaaaaagaatatgcaccttct |
47774768 |
T |
 |
| Q |
208 |
tggtatgcatagt |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47774769 |
tggtatgcatagt |
47774781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University