View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_160 (Length: 217)
Name: NF3223_low_160
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_160 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 17005231 - 17005415
Alignment:
| Q |
16 |
cagagccataaacttcagctgtgtcgataaaggttagacccccatcaatacttgtattgaatgcatctctagcagctttctcattcctatctaaaattac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17005231 |
cagagccataaacttcagctgtgtcgataaaggttagacccccatcaatacttgtattgaatgcatctctagcagctttctcattcctatctaaaattac |
17005330 |
T |
|
| Q |
116 |
cataaggcaagaagattgatgataattgttatctaatgatccttgagtagaaattagtaaatgaattcaaaaattatgatccatg |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
17005331 |
cataaggcaagaagattgatgatgattgttatctaatcatccttgagtagaaattagaaaatgaattcaaaaataatgatccatg |
17005415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University