View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_164 (Length: 213)
Name: NF3223_low_164
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_164 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 37452807 - 37453004
Alignment:
| Q |
1 |
ttctataaattattgagaaaataaagtattgaatcataaccttgcatgcatggaaaaccgaggtgaatttatcaacatttgatttttcaactaatgaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37452807 |
ttctataaattattgagaaaataaagtattgaatcataaccatgcatgcatggaaaaccgaggtgaatttatcaacatttgatttttcaactaatcaccg |
37452906 |
T |
 |
| Q |
101 |
taatttggtagagtttgtttaactcatcttataacagcaaggggattagtattaagtgaattgagagcaaagttaaactgaaaaaacatatatgtatt |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37452907 |
taatttggtagagtctgtttaactcatcttataacagcaaggggattagtattaagtgaattgagagcaaagttaaactgaaaaaacatatatgtatt |
37453004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University