View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_165 (Length: 209)
Name: NF3223_low_165
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_165 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 19149144 - 19149345
Alignment:
| Q |
1 |
acatatatgaatgttcaaataacataactcatgatnnnnnnntgaagcataaaaatcttcaatcaattattttaggggcaggtgatgtattgtttgtttc |
100 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19149144 |
acatatatggatgttcaaataacacaactcatgatgaaaaa-tgaagcatagaaatcttcaatcaattattttaggggcaggtgatgtattgtttgtttc |
19149242 |
T |
|
| Q |
101 |
aagcatatggagtgtttttaatagagtaaagaggatgtggcatttacacaagtagaatatgtttcttcgcaagttaattgttttagggatttcattcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19149243 |
aagcatatggagtgtttttaatagagcaaagaggatgtggcaattacacaagtagaatatgtttcttcgcaagttaattgtttta-ggatttcattcata |
19149341 |
T |
|
| Q |
201 |
tcac |
204 |
Q |
| |
|
|||| |
|
|
| T |
19149342 |
tcac |
19149345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University