View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_39 (Length: 389)
Name: NF3223_low_39
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 49 - 374
Target Start/End: Original strand, 48842452 - 48842777
Alignment:
| Q |
49 |
tctcgcattctacgaatgatgaacaatc-atccaaaaacacaccaaagtttgttgtttagcactcatggtatacatcttgaactgaccattttatctccg |
147 |
Q |
| |
|
||||||||| | ||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48842452 |
tctcgcattttccgagggatgaacaatccatccaaaaacacaccaaagtttgttgtttagcaatcatggtatacatcttgaactgtccattttatctcca |
48842551 |
T |
|
| Q |
148 |
gtagcagttaacgatcgttcgttggggaatggcaattaactatcttttcagacctacgtatacatgatcacnnnnnnnnnnnnnnnnntcttagtttggt |
247 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48842552 |
gtagcggttaacgatcgttcgttggggaacggcaattaactatcttttcagacctacgtatacatgatcacaaaaggaaaagaaaaa-tcttagtttggt |
48842650 |
T |
|
| Q |
248 |
ggtgtggctatctaaaattatatatgtccttgtaggaagcatatgataaatttgtgatcgattagagacgtgtggctgttacaagtgtgttttgagttgg |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48842651 |
ggtgtggctatctaaaattatatatgtccttgtaggaagcatatgataaatttgtgatcgattagagacgtgtggctgttacaagtgtgttttgagttgg |
48842750 |
T |
|
| Q |
348 |
tattgctggaccggttggtattgcatg |
374 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
48842751 |
tattgttggaccggttggtattgcatg |
48842777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 285 - 366
Target Start/End: Original strand, 43543690 - 43543771
Alignment:
| Q |
285 |
agcatatgataaatttgtgatcgattagagacgtgtggctgttacaagtgtgttttgagttggtattgctggaccggttggt |
366 |
Q |
| |
|
|||| ||||||||||||| ||||||| ||||||||| |||||||| ||| ||||| |||||||| ||| ||| || |||||| |
|
|
| T |
43543690 |
agcagatgataaatttgtcatcgattggagacgtgttgctgttactagtatgtttggagttggttttgttggtcctgttggt |
43543771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University