View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_44 (Length: 382)
Name: NF3223_low_44
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 18 - 341
Target Start/End: Complemental strand, 35769963 - 35769640
Alignment:
| Q |
18 |
aaagattagtgtctcacagactgataggtgaggatagaagatgtcatgttgcgcaacaaatcctaagttttgtttcactgattttgagagtggttttcca |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35769963 |
aaagactagtgtctcacagactgataggtgaggatagaagatgtcatgttgcgcaacaaatcctaagttttgtttcactgattttgagagtggttttcca |
35769864 |
T |
 |
| Q |
118 |
ttgtaagttatttatggttccttttgttctcatttaatctgcctcctaaagcatttattagagttgatttgccactgcctgaagggcctaaaattgctaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35769863 |
ttgtaagttatttatggttccttttgttctcatttaatctgcctcctaaagcatttattagagttgatttgccactgcctgaagggcctaaaattactaa |
35769764 |
T |
 |
| Q |
218 |
caattcacccggaaatacaatgccaataatccctttcaagattagtttctcctcagaatttatagcctttttgcataacaagcctttgcttttgctggtt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35769763 |
caattcacccggaaatacaatgccaataatccctttcaagattagtttctcctcagaatttatagcctttttgcataacaagcctttgcttttgctggtt |
35769664 |
T |
 |
| Q |
318 |
ttggttttatgcacgacataataa |
341 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35769663 |
ttggttttatgcacgacataataa |
35769640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University