View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_62 (Length: 338)
Name: NF3223_low_62
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 7172923 - 7172598
Alignment:
| Q |
1 |
cttcatggaattttgggtgtatgtctttcttcttacaatacactccgaaatttcccacnnnnnnnccttgttgattctgcaactacnnnnnnnnnncatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||||| |||| |
|
|
| T |
7172923 |
cttcatggaattttgggtgtatgtctttcttcttacaatacactccgaaattgcccactttttttcctttttgattctgcaactacaaaaaaaaa-catg |
7172825 |
T |
 |
| Q |
101 |
ttggttagtttaatacagaaacaataatatgaataattggaaattttaaggaagtggttggttactacgttttttgtgggaagtggaaggaatggttttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7172824 |
ttggttagtttaatacagaaacaataat---------tggaaattttaaggaagtggttggttactacgttttttgtgggaagtggaaggaatggttttc |
7172734 |
T |
 |
| Q |
201 |
cttgaataaaggtattggtaatgcactgcgccannnnnnngcagatgagattagatatgagaatttgagattgtgtggtgtggacatatgttcttgttct |
300 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7172733 |
cttgaacaaaggtattggtaatgcactgcgccatttttttgcagatgagattagatatgagaatttgagattgtgtggtgtggacatatgttcttgttct |
7172634 |
T |
 |
| Q |
301 |
tgtttgtagttcaaaatgggctttttctttcatttc |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7172633 |
tgtttgtagttcaaaatgggctttttctttcatttc |
7172598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University