View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_63 (Length: 335)
Name: NF3223_low_63
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_63 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 10274710 - 10274514
Alignment:
| Q |
1 |
tctttggctttttatgaacttttctttatctaacttcattttatcattaccctatttcatttgtggtggcacaaaagctcggtaacaacgaccttcgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274710 |
tctttggctttttatgaacttttctttatctaacttcattttatcattaccctatttcatttgtggtggcacaaaagctcggtaacaacgaccttcgtta |
10274611 |
T |
|
| Q |
101 |
ccgaaggtgtgttcggtatctgatatatgtctcatgccaatactaacatatatgattacatgtgttgatgtatcagtatcatatgtgtatgtccttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10274610 |
ccgaaggtgtgttcggtatctgatatatgtctcatgccaatactaacatatatgattacatgtgttgatctatcagtatcatatgtgtatgtccttc |
10274514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 10266795 - 10266726
Alignment:
| Q |
1 |
tctttggctttttatgaacttttctttatctaacttcattttatcattaccctatttcatttgtggtggc |
70 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
10266795 |
tctttggctttttctgaacatttctttatctaactttattttatcgttaccccatttcatttgtggtggc |
10266726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 260 - 324
Target Start/End: Complemental strand, 10274450 - 10274384
Alignment:
| Q |
260 |
ctcactcattgattcacttgataata--agtgtttattttttagggtttaatatcattttcgttcat |
324 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10274450 |
ctcactcattgattcacttgataataagagtgtttattttttattttttaatatcattttcgttcat |
10274384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University