View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_71 (Length: 319)
Name: NF3223_low_71
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_71 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 300
Target Start/End: Original strand, 10011371 - 10011650
Alignment:
| Q |
11 |
cacagagcttggatttggacaacaaagaggggtgttcatcttttgcagaaaaaataagaaatcctcggtgatcattgaatcgatccaaaacatgtcgtaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10011371 |
cacagagcttggatttggacaacaaagaggggtgttcatcttttgcagaaaaaataagaaatcctcggtgatcattgaatcgatccaaaacatgtcgtaa |
10011470 |
T |
 |
| Q |
111 |
atttcgttgttgaagaaggttgatgaaggattctggcggagaacatgcagctatggagatggcgttgaagagttggatggatgctgtgttgttgaaccaa |
210 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
10011471 |
atttcgttgttga----------tgaaagattctggcggagaacatgcagctatggagatggcattgaagagttggatggatactgtgctgttgaaccaa |
10011560 |
T |
 |
| Q |
211 |
gggaagagagcactgtgattcctatagttagcatgggaagaagagctagaatnnnnnnngttatgatagatgctggtttagtgtgtgaac |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10011561 |
gggaagagagcactgtgattcctaaagttagcatgggaagaagagctagaataaaaaaagttatgatagatgctggtttagtgtgtgaac |
10011650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University