View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_95 (Length: 260)
Name: NF3223_low_95
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_95 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 30 - 240
Target Start/End: Complemental strand, 53712841 - 53712630
Alignment:
| Q |
30 |
tcgacatcgcttataatcctcatcaaagataatgaaagctgtaaagcatgtgtattattggacacttgccatttcgaggttcctttcaagttttttgagg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53712841 |
tcgacatcgcttataatcctcatcaaagataatgaaagctgtaaagcatgtgtattattggacacttgccatttcgaggttcctttcaagttttttgagg |
53712742 |
T |
|
| Q |
130 |
gaaatttttaacctttattattttatacgtaattgatgacattt-nnnnnnnnnnnnnnnnntattttggtatatatatatttctcatgaccgtgcaatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53712741 |
gaaatttttaacctttattattttatacgtaattgatgacatttaaaaaaaaaaaaaaaaaatcttttggtatatatatatttctcatgaccgtgcaatg |
53712642 |
T |
|
| Q |
229 |
caacgatcgtct |
240 |
Q |
| |
|
|||||||||||| |
|
|
| T |
53712641 |
caacgatcgtct |
53712630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 240
Target Start/End: Original strand, 6817000 - 6817037
Alignment:
| Q |
203 |
tatatatttctcatgaccgtgcaatgcaacgatcgtct |
240 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
6817000 |
tatatagttctcatgaccttgcaatgcaacgatcgtct |
6817037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University