View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_96 (Length: 260)
Name: NF3223_low_96
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_96 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 6714142 - 6713925
Alignment:
| Q |
19 |
tgtttaatatcttggtataggttcttgctttgcggatcaattatctagggttttctagtttccaatcaaagagatgtggtctctgacttacgtacccttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6714142 |
tgtttaatatcttggtataggttcttgctttgcggatcaattatctagggttttctagtttccaatcaaagagatgtggtctctgacttacgtacccttt |
6714043 |
T |
|
| Q |
119 |
gatgtaaggc-------------nnnnnnnnnatccaagaacaagatttaagggtggannnnnnnaacctcattagtagtgaaaccctaactcttatgga |
205 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6714042 |
gatgtaaggcttttttttttttttttttttttatccaagaacaagatttaagggtggatttttttaacctcattagtagttaaaccctaactcttatgga |
6713943 |
T |
|
| Q |
206 |
ggataatgtgtcttgggt |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6713942 |
ggataatgtgtcttgggt |
6713925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 223 - 251
Target Start/End: Complemental strand, 6713877 - 6713849
Alignment:
| Q |
223 |
tgttgattgtgcccctatgttttgatgat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6713877 |
tgttgattgtgcccctatgttttgatgat |
6713849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University