View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3223_low_98 (Length: 257)
Name: NF3223_low_98
Description: NF3223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3223_low_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 36715181 - 36715431
Alignment:
| Q |
1 |
aaaaattgcagtgatatgggtgaaaattatgctgacatcaattgggaaggacttagttttagtctgactcaaacagattacatgcatgtcatgaaatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36715181 |
aaaaattgcagtgatatgggtgaaaattatgctgacatcaattgggaaggacttagttttagtctgactcaaacagattacatgcatgtcatgaaatgca |
36715280 |
T |
|
| Q |
101 |
caaaaggagaaaagttttctcaaggatccctcattcgctatggaaacattgagataagcccggctgctggtatcataaactatggacaggttaaaagtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36715281 |
caaaaggagaaaagttttctcaaggatccctcattcgctacggaaacattgagataagcccggctgctggtatcataaactatggacaggttaaaagtgc |
36715380 |
T |
|
| Q |
201 |
acaatatatgtttgttaaaatacctactgaaagatgatttatattcttgga |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
36715381 |
acaatatatgtttgttaaaatacctagtgaaagatgatttatattgttgga |
36715431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University