View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3225_low_3 (Length: 325)
Name: NF3225_low_3
Description: NF3225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3225_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 23 - 250
Target Start/End: Original strand, 17168472 - 17168697
Alignment:
| Q |
23 |
tcgtttgttgttgtcacccttaaatctcaccaaccatctaacatcactcagctaactatttaataataaaaactcattcataatcttttgttataagaat |
122 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17168472 |
tcgtttgccgttgtcacccttaaatctcaccaaccatctaacatcacccaactggctatttaataataaaaactcattcataatctttt-ttataagaat |
17168570 |
T |
|
| Q |
123 |
cattaataatccataacaacgnnnnnnnngaaaataataaatagtccaaaattctctttgaccacccttcagtcaccggaaaccgcctcgttgccgtcgg |
222 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||||||||| |||||||||||| ||||||| ||||| |||| ||| ||| || |
|
|
| T |
17168571 |
cattaataatccatatcaac-acaaaaaagaaaaaaataaatagtccaaaattctctctgaccacccttccgtcaccgaaaaccacctcattgtcgttgg |
17168669 |
T |
|
| Q |
223 |
actacgccttttctctcttctccgctct |
250 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
17168670 |
actacgccttttctctcttctccactct |
17168697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University