View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226-Insertion-20 (Length: 129)
Name: NF3226-Insertion-20
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226-Insertion-20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 5e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 51 - 118
Target Start/End: Complemental strand, 3753053 - 3752986
Alignment:
| Q |
51 |
aggaagaaattgtgagatctggtgaaaaaacttggtacaacattgttgctgaaaagagaagaagaggg |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3753053 |
aggatgaaattgtgagatctggtgaaaaaacttggtacaacattgttgctgaaaagaggagaagaggg |
3752986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 7e-19
Query Start/End: Original strand, 51 - 118
Target Start/End: Original strand, 4047185 - 4047252
Alignment:
| Q |
51 |
aggaagaaattgtgagatctggtgaaaaaacttggtacaacattgttgctgaaaagagaagaagaggg |
118 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||| || ||||||||| ||||||||| |
|
|
| T |
4047185 |
aggaagatattgtaagatctggtgaaaaaacttggtacaacattgctgttgaaaagaggagaagaggg |
4047252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University