View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226-Insertion-25 (Length: 231)
Name: NF3226-Insertion-25
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226-Insertion-25 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 5 - 231
Target Start/End: Complemental strand, 47986904 - 47986678
Alignment:
| Q |
5 |
acacattcttctcctacaatttagatatcagatttcagaaggccttaacatgaattggccaactgaaagactgaaattcttgaataagagaaactaaact |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47986904 |
acacattcttctcctacaatttagatatcagatttcagaaggccttaacatgaattggccaactgaaagactgaaattcttgaataagagaatctaaact |
47986805 |
T |
|
| Q |
105 |
aatgcacttttgaggatgcatagaatacttgtgttctttgtctgaattttataggaaagccgctttatttaaggttgttttaaagctgtatgtggagatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47986804 |
aatgcacttttgaggatgcatagaatacttgtgttctttgtctgaattttataggaaagccgctttatttaaggttgttttaaagctgtatgtggagatt |
47986705 |
T |
|
| Q |
205 |
ctccactagagtttggttgtttgaaca |
231 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
47986704 |
ttccactagagtttggttgttttaaca |
47986678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University