View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_1D_high_16 (Length: 206)
Name: NF3226_1D_high_16
Description: NF3226_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_1D_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 29 - 112
Target Start/End: Complemental strand, 38886047 - 38885964
Alignment:
| Q |
29 |
gtttggtgtttacaaggttgtggaagtgtttgggttgaaagtgagagaatgccacaacaactttatgttcagtttgctgaaatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38886047 |
gtttggtgtttacaaggttgtggaagtgtttgggttgaaagtgagagaatgccacaacaactttatgttcagtttgctgaaatg |
38885964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University