View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_1D_low_10 (Length: 339)
Name: NF3226_1D_low_10
Description: NF3226_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_1D_low_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 23 - 339
Target Start/End: Original strand, 44040978 - 44041291
Alignment:
| Q |
23 |
aagaccacccctttctttctcacttcttaccaaattcttcttcctcggccttgtcgggtatgtgtgtaattgcattacattagtcgtattatttaaggtt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44040978 |
aagaccacccctttctttctcacttcttgccaaatttttcttcctcggccttgtcgggtatgtgtgtaattgcattacattagtcgtattatttaaggtt |
44041077 |
T |
|
| Q |
123 |
tcaaatcgtgatcgcatgatttgactgatactcaaacataaaaggctttgtaatagcgtggcggccacaactgtggtggctgattatttaaggtttcaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44041078 |
tcaaatcgtgatcgcatgatttgactgatactcaaacataaaaggctttgtaacagcttagcggccacaactgtggtggctgattatttaaggttttaaa |
44041177 |
T |
|
| Q |
223 |
tggcgattgcatgaattcgaccgatactggaactaaaagagtttataattgcagccacaactgtggtggctgattgtttttaaaatcttgattgtgtcta |
322 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041178 |
tggcgattgcatggattcgactgatactggaactaaaaga---tttaattgcggccacaactgtggtggctgattgtttttaaaatcttgattgtgtcta |
44041274 |
T |
|
| Q |
323 |
ttttctatccctttatg |
339 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44041275 |
ttttctatccctttatg |
44041291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University