View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3226_1D_low_11 (Length: 330)

Name: NF3226_1D_low_11
Description: NF3226_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3226_1D_low_11
NF3226_1D_low_11
[»] chr2 (2 HSPs)
chr2 (114-330)||(6490978-6491194)
chr2 (147-272)||(41869846-41869970)
[»] chr3 (2 HSPs)
chr3 (1-117)||(49866186-49866302)
chr3 (114-254)||(15297648-15297787)
[»] chr5 (2 HSPs)
chr5 (174-296)||(39709506-39709628)
chr5 (174-254)||(39718196-39718276)


Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 114 - 330
Target Start/End: Complemental strand, 6491194 - 6490978
Alignment:
114 gttgtcttcagcttcttggatggtggtgtgattttcttgaaaaccaatgggagcttgatctttggaatcgtggaattgtttggtgctctccctcttgcaa 213  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
6491194 gttgtcttcagcttcttgggtggtggtgtgattttcttgaaaaccaatgggaacttgatctttggaatcgtggaattgtttggtgctctccctcttgcaa 6491095  T
214 agcttggctgggatggtggcagtcttaataatctgaatgcaggggaaacagaccctatgtcgtgaagccgtctcattgtacatcagatcaactgcgccat 313  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
6491094 agcttggctgggatggtggcagtcttaataatctgaatgcaggggaaacaaaccctatgtcgtgaagccgtctcattgtacatcagatcaactgcgccat 6490995  T
314 ttagagtggtgtcacgg 330  Q
    |||||||||||||||||    
6490994 ttagagtggtgtcacgg 6490978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 147 - 272
Target Start/End: Complemental strand, 41869970 - 41869846
Alignment:
147 ttcttgaaaaccaatgggagcttgatctttggaatcgtggaattgtttggtgctctccctcttgcaaagcttggctgggatggtggcagtcttaataatc 246  Q
    |||||| | ||||| |||| |||||| |||||||| |||||| || || ||||||||||| ||||| || || |||||||||||||| |||||||| |||    
41869970 ttcttgtacaccaaggggaacttgat-tttggaattgtggaactgcttagtgctctcccttttgcacagattagctgggatggtggccgtcttaatgatc 41869872  T
247 tgaatgcaggggaaacagaccctatg 272  Q
    || ||||| || || | |||||||||    
41869871 tggatgcaaggaaatctgaccctatg 41869846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 49866302 - 49866186
Alignment:
1 tgttttgtatcttacttcatcttttcaaaatgttccctgctgaaatttggaagttttcaagatcttaatatgatgtttgtctttccaaaacacatcgccg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||    
49866302 tgttttgtatcttacttcatcttttcaaaatgttccctgctgaaatttggaagttttcaagatctttatatgatgtttggctttccgaaacacatcgccg 49866203  T
101 atgcttagttaaggttg 117  Q
    |||||| ||||| ||||    
49866202 atgcttggttaaagttg 49866186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 114 - 254
Target Start/End: Complemental strand, 15297787 - 15297648
Alignment:
114 gttgtcttcagcttcttggatggtggtgtgattttcttgaaaaccaatgggagcttgatctttggaatcgtggaattgtttggtgctctccctcttgcaa 213  Q
    |||||||| |||||| ||| ||| ||  | || |||||||| ||||| |||| |||||| ||| || | ||| || ||||| ||||||||||| ||||||    
15297787 gttgtcttgagcttcctggttgggggcctaatcttcttgaacaccaacgggaacttgat-tttagagttgtgaaactgtttcgtgctctcccttttgcaa 15297689  T
214 agcttggctgggatggtggcagtcttaataatctgaatgca 254  Q
    || || |||||||| ||||||||||| || ||||| |||||    
15297688 aggttagctgggattgtggcagtcttgatgatctggatgca 15297648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 174 - 296
Target Start/End: Complemental strand, 39709628 - 39709506
Alignment:
174 tttggaatcgtggaattgtttggtgctctccctcttgcaaagcttggctgggatggtggcagtcttaataatctgaatgcaggggaaacagaccctatgt 273  Q
    |||||||| ||| || || || ||||||||||| ||||| || || || |||||||||||||||||||| || ||||||||||| || | |||||||||     
39709628 tttggaattgtgaaactgcttagtgctctcccttttgcacagattagccgggatggtggcagtcttaatgatttgaatgcagggaaacctgaccctatga 39709529  T
274 cgtgaagccgtctcattgtacat 296  Q
    || || ||| |||| ||||||||    
39709528 cgagatgccatctcgttgtacat 39709506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 254
Target Start/End: Complemental strand, 39718276 - 39718196
Alignment:
174 tttggaatcgtggaattgtttggtgctctccctcttgcaaagcttggctgggatggtggcagtcttaataatctgaatgca 254  Q
    |||||||| ||| || || || |||||||| || ||||| || || ||||||||||||||||||||||| || ||||||||    
39718276 tttggaattgtgaaactgcttagtgctctctcttttgcacagattagctgggatggtggcagtcttaatgatttgaatgca 39718196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University