View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_1D_low_15 (Length: 310)
Name: NF3226_1D_low_15
Description: NF3226_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_1D_low_15 |
 |  |
|
| [»] scaffold0054 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0054 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 21 - 305
Target Start/End: Complemental strand, 38572 - 38290
Alignment:
| Q |
21 |
caatatcatcatgtctatagctgttgttcacctttttgtttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagattgttgaatac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38572 |
caatatcatcatgtctatagctgttgttcacctttttgtttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagattgttgaatac |
38473 |
T |
 |
| Q |
121 |
agatagcgtgagtagggaatagggatggttctcgagctggtggtcgtggtttgtttagagtgagtaacagtgagtgcctttgttgttctggaaagctgtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| || |
|
|
| T |
38472 |
agatagcgtgagtagggaatagggatggttctcgagctggtggtcgtggtttgtttagagtgagtaacggtgagtgcctttgttgttttggaaagctctt |
38373 |
T |
 |
| Q |
221 |
gtggacgtcaagtgcggttttgtggggtgtattggaagttttgataatgacgaaagagtatgagcggaagggatccaacaccaaa |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38372 |
gtggacgtcaagtgcggttttgtggggtgtattggaagttttgataatgacgaaagagtatgagcggaagg--tccaacaccaaa |
38290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 55
Target Start/End: Complemental strand, 42720 - 42686
Alignment:
| Q |
21 |
caatatcatcatgtctatagctgttgttcaccttt |
55 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
42720 |
caatatcatcatgtatatagctgttgttcaccttt |
42686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 36 - 120
Target Start/End: Original strand, 32958500 - 32958584
Alignment:
| Q |
36 |
tatagctgttgttcacctttttgtttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagattgttgaatac |
120 |
Q |
| |
|
||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958500 |
tatagttgttgttcgccttttcttttgagagaatgaagttcagcggttgcagattggaatacgagtgaatgagattgttgaatac |
32958584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University