View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_1D_low_18 (Length: 282)
Name: NF3226_1D_low_18
Description: NF3226_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_1D_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 10 - 263
Target Start/End: Complemental strand, 15854801 - 15854570
Alignment:
| Q |
10 |
tgtcatatgtcggatttttggctttccgccatcgataatattgcttagtgttctgctttacttatctggattctgggcttcatgctctatggtgattaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15854801 |
tgtcatatgtcggatttttggctttccgccatcgataatattgcttagtgttctgctttacttatctggattctggccttcatgctctatggtgattaac |
15854702 |
T |
|
| Q |
110 |
taaattaaaaattaatatttcatgattaataatgaaatagggaatactcggttgtgatgatggagttgatgatttgaactttgtttcaggggggaggatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15854701 |
taaattaaaaattaatatttcatgattaata----------------------gtgatgacggagttgatgatttgaactttgtttcaggggggaggatg |
15854624 |
T |
|
| Q |
210 |
attatatgccaggaaacattatagagatagaacttcataatttcatgacatttg |
263 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15854623 |
attatatgcctggaaacattatagagatagaacttcataatttcatgacatttg |
15854570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 29032107 - 29032071
Alignment:
| Q |
16 |
atgtcggatttttggctttccgccatcgataatattg |
52 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
29032107 |
atgtcggatctttggctttccgccatcgataacattg |
29032071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 159 - 263
Target Start/End: Original strand, 10690663 - 10690767
Alignment:
| Q |
159 |
ggttgtgatgatggagttgatgatttgaactttgtttcaggggggaggatgattatatgccaggaaacattatagagatagaacttcataatttcatgac |
258 |
Q |
| |
|
|||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
10690663 |
ggttgtgactatggagttgatgagttgagttttgtttcaggggggaggatgattatatgcctggaaacattttagagatcgaacttcataatttcatgac |
10690762 |
T |
|
| Q |
259 |
atttg |
263 |
Q |
| |
|
||||| |
|
|
| T |
10690763 |
atttg |
10690767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 25868964 - 25868924
Alignment:
| Q |
15 |
tatgtcggatttttggctttccgccatcgataatattgctt |
55 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
25868964 |
tatgtcggatttttggctttccgccattgataacattgctt |
25868924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 189 - 263
Target Start/End: Original strand, 47430585 - 47430659
Alignment:
| Q |
189 |
tttgtttcaggggggaggatgattatatgccaggaaacattatagagatagaacttcataatttcatgacatttg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||| || || |||||||||||||||||||||| |
|
|
| T |
47430585 |
tttgtttcaggggggaggatgattatatgcctggaaacattttagaaatcgagcttcataatttcatgacatttg |
47430659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University