View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_1D_low_26 (Length: 241)
Name: NF3226_1D_low_26
Description: NF3226_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_1D_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 7 - 231
Target Start/End: Complemental strand, 45608540 - 45608332
Alignment:
| Q |
7 |
attttatcattatgatttatgaggactgaggaattaggaattgttatcaccattatttacatagtaacagtctctacaaagtagtcatagttgaaaatat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | || |||||||||| |
|
|
| T |
45608540 |
attttatcattatgatttatgaggactgaggaattaggaattgttatcaccattatttacgtagtaaca-tgact---------------ttgaaaatat |
45608457 |
T |
 |
| Q |
107 |
ttgagtgcatggtatcatggttagtttgataaaatcacaatgacgctatgattttgttgaagctataaattatagtttttgtaagaatcaccatgatacc |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45608456 |
ttgagcgcatggtatcatggttagtttgattaaatcacaatgacgctatgattttgttgaagctataaattatagtttttgtaagaatcaccgtgatacc |
45608357 |
T |
 |
| Q |
207 |
tgttaagcactttattgatgccttc |
231 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
45608356 |
tattaagcactttattgatgccttc |
45608332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Original strand, 50528495 - 50528525
Alignment:
| Q |
157 |
attttgttgaagctataaattatagtttttg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50528495 |
attttgttgaagctataaattatagtttttg |
50528525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 170
Target Start/End: Complemental strand, 5433486 - 5433445
Alignment:
| Q |
129 |
agtttgataaaatcacaatgacgctatgattttgttgaagct |
170 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5433486 |
agtttgataaaatcacaatgtcgctatgattttgttgaagct |
5433445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University