View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_1D_low_30 (Length: 213)
Name: NF3226_1D_low_30
Description: NF3226_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_1D_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 9546127 - 9546232
Alignment:
| Q |
18 |
tttctgcaacttgtttatttttcttgtgactcgctctgtgtccacctagtgcttgatatgaacgaaacactttgttacacgtgtcgcatttgtatcttcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546127 |
tttctgcaacttgtttatttttcttgtgactcgctctgtgtccacctagtgcttgatatgaacgaaacactttgttacacgtgtcgcatttgtatcttcc |
9546226 |
T |
|
| Q |
118 |
tcgtac |
123 |
Q |
| |
|
|||||| |
|
|
| T |
9546227 |
tcgtac |
9546232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University