View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_1D_low_34 (Length: 201)
Name: NF3226_1D_low_34
Description: NF3226_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_1D_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 7 - 184
Target Start/End: Complemental strand, 40528304 - 40528127
Alignment:
| Q |
7 |
cagagacctaatgtggctagagatcaagttgtatcaatagaagtagataggcaaaggaatagacttcaagctactgaggcaatggctgaggctagagtcg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40528304 |
cagagacctaatgtggctagagatcaagttgtatcaatagaagtagataggcaaaggaatagacttcaagctactgaggcaatggctgaggctagagtcg |
40528205 |
T |
|
| Q |
107 |
aagcagaacgtggtgatttgactgctgcaatttctgtcctagaaagatgtcaaagggcattatctgaaactatttctg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40528204 |
aagcagaacgtggtgatttgactgctgcaatttctgtcctagaaagatgtcaaagggcattatctgaaactatttctg |
40528127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 35366005 - 35366124
Alignment:
| Q |
8 |
agagacctaatgtggctagagatcaagttgtatcaatagaagtagataggcaaaggaatagacttcaagctactgaggcaatggctgaggctagagtcga |
107 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||||||||||||| |||||||||| || |||||||| |||||| ||||||||||||||| |
|
|
| T |
35366005 |
agagagctaatgtggctagagatcaaggtgtatcaaccgaagtagataggcaaatgaatagactttaaactactgagacaatggttgaggctagagtcga |
35366104 |
T |
|
| Q |
108 |
agcagaacgtggtgatttga |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35366105 |
agcagaacgtggtgatttga |
35366124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University