View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_high_24 (Length: 325)
Name: NF3226_high_24
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_high_24 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 325
Target Start/End: Original strand, 40662494 - 40662801
Alignment:
| Q |
18 |
tttctctgtcgatcaaactacttccatctctcaggtttattcaaacacacacttttctgcccctgcatttatcattgtttctttcattcctgaataaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40662494 |
tttctctgtcgatcaaactacttccatctctcaggtttattcaaacacacacttttttgcctctgcatttatcattgtttctttcattcctgaatacaaa |
40662593 |
T |
 |
| Q |
118 |
tccnnnnnnnaattgggatttctaacttttgttttaattatgatggcccagatgcaggataatttgttattatactcaagagcttattggctcactcaat |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40662594 |
tcctttttttaattgggatttctaacttttgttttaattatgatggcccagatgcaggataatttgttattgtactcaagagcttattggctcactcaat |
40662693 |
T |
 |
| Q |
218 |
ctcttattgcttggaatgttgatcatcatcaaaatgggatttgttacctactttccagtaaagatgcttctttgaacatttctaattctcaaattcaagg |
317 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40662694 |
cgcttattgcttggaatgttgatcatcatcaaaatgggatttgttacctactttccagtaaagatgcttctttgaacatttctaattctcaaattcaagg |
40662793 |
T |
 |
| Q |
318 |
ttatattt |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
40662794 |
ttatattt |
40662801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University