View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3226_high_41 (Length: 241)

Name: NF3226_high_41
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3226_high_41
NF3226_high_41
[»] chr3 (1 HSPs)
chr3 (202-241)||(46267357-46267396)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 46267396 - 46267357
Alignment:
202 aagaattagagtgaacaagagatcaaaggttgtaataagc 241  Q
    ||||||||||||||||||||||||||||||||||||||||    
46267396 aagaattagagtgaacaagagatcaaaggttgtaataagc 46267357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University