View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_high_47 (Length: 228)
Name: NF3226_high_47
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 220
Target Start/End: Complemental strand, 30616165 - 30615955
Alignment:
| Q |
10 |
cctggaacattgccaccaaacgttgcagcaacagttaacggcctcgctttagttggaacatttaccggacaactcttcttcggctggctcggtgacaaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30616165 |
cctggaacattgccaccaaacgttgcagcaacagttaacggcctcgctttagttggaacatttaccggacaactcttcttcggctggctcggtgacaaac |
30616066 |
T |
|
| Q |
110 |
taggccgtagaacagtctatggaatcactctaaacattatgattatttgttccctaggttctggtctttcatttggacatgaaccaaaaatggtgttggg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30616065 |
taggccgtagaacagtctatggaatcactctaaacattatgattatttgttccctaggttctggtctttcatttggacatgaaccaaaaatggtgttggg |
30615966 |
T |
|
| Q |
210 |
aactctctgct |
220 |
Q |
| |
|
|||||| |||| |
|
|
| T |
30615965 |
aactctttgct |
30615955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 30620907 - 30620706
Alignment:
| Q |
19 |
ttgccaccaaacgttgcagcaacagttaacggcctcgctttagttggaacatttaccggacaactcttcttcggctggctcggtgacaaactaggccgta |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||| | ||||| ||||| ||| || | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620907 |
ttgccaccaaacgttgcagcagcagttaatggcgttgcttttgttgggacactttctggacaactcttcttcggctggctcggtgacaaactaggccgta |
30620808 |
T |
|
| Q |
119 |
gaacagtctatggaatcactctaaacattatgattatttgttccctaggttctggtctttcatttggacatgaaccaaaaatggtgttgggaactctctg |
218 |
Q |
| |
|
|| ||||||||| || |||||| ||||| || |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
30620807 |
aaaaagtctatggcatgactctagctgttatggttgtttgttccataggttctggtctttcatttggacatgaaccaaaaacagtgttgggaactctttg |
30620708 |
T |
|
| Q |
219 |
ct |
220 |
Q |
| |
|
|| |
|
|
| T |
30620707 |
ct |
30620706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University