View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_high_53 (Length: 203)
Name: NF3226_high_53
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_high_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 70 - 143
Target Start/End: Original strand, 42396982 - 42397055
Alignment:
| Q |
70 |
ttggatctcttgatcttatttagaattgccaaatgttttttatcaaaagataaaatgaattgctaagtattgtt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
42396982 |
ttggatctcttgatcttatttagaattgccaaatattttttatcaaaagacaaaaagaattgctaagtattgtt |
42397055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 127 - 185
Target Start/End: Original strand, 42397067 - 42397125
Alignment:
| Q |
127 |
aattgctaagtattgttgtctgttgatatttatttgaatagttcttcccattgaatatt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42397067 |
aattgctaagtattgttgtctgttgatatttatttgaatagttcttcccattgaatatt |
42397125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University