View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_low_11 (Length: 402)
Name: NF3226_low_11
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 214 - 388
Target Start/End: Complemental strand, 8679647 - 8679473
Alignment:
| Q |
214 |
cttgcagtggattttgcatgattggggggatgaagaatgcatccaaatattgaagaaatgtaaggaagctattccaaatgacaatggaagagtaattatc |
313 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8679647 |
cttgcagcggattttgcatgattggggggatgaagaatgcatccaaatattgaagaaatgtaaggaagctattccaaatgacaatggaagagtaattatc |
8679548 |
T |
 |
| Q |
314 |
gtggaagcagtgattgaagaaggaggaaaccacaagtataaagatgtagggttagtcttagatacggtgatgatg |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||| |
|
|
| T |
8679547 |
gtggaagcagtgattgaagaaggaggaaaccacaagtataaagatgtagggttagtgttagacatggtgatgatg |
8679473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 216 - 388
Target Start/End: Complemental strand, 37740446 - 37740268
Alignment:
| Q |
216 |
tgcagtggattttgcatgattggggggatgaagaatgcatccaaatattgaagaaatgtaaggaagctattccaaatgacaatggaagagtaattatcgt |
315 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||| || ||||| |||| ||||| |||||||| || ||||||| ||| ||||| || |
|
|
| T |
37740446 |
tgcagtgggttttgcatgattggggggatgaagagtgcatccaaatcttaaagaactgtagagaagcaattccaaaagaaaatggaaaagttattattgt |
37740347 |
T |
 |
| Q |
316 |
ggaagcagtgattgaagaagg---aggaa---accacaagtataaagatgtagggttagtcttagatacggtgatgatg |
388 |
Q |
| |
|
||||||||||||||||||||| ||||| || ||||||||||||| ||||||||| | ||||| | |||||||||| |
|
|
| T |
37740346 |
ggaagcagtgattgaagaaggagaaggaaaacacaacaagtataaagacgtagggttaatgttagacatggtgatgatg |
37740268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University