View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_low_35 (Length: 251)
Name: NF3226_low_35
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 41979553 - 41979314
Alignment:
| Q |
1 |
ttcatttcagaaatcttggaagtcaaggcttgaaagggaacataagtgaccaaattagtcttttgtcagacttggtaaccctgtaagtttgatcagctgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41979553 |
ttcatttcagaaatcttggaagtcaaggcttgaaagggaacataagtgaccaaattagtcttttgtcagacttggtaaccctgtaagtttgttcagctgc |
41979454 |
T |
 |
| Q |
101 |
ccaatttctttacatatgtattgttcacaaaacactgacttgaattaagaatatactaattaacctagatttgtaatattccctcgattgagaacactgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41979453 |
ccaatttctttacatatgtattgttcacaaaacactgacttgaattaagaatatactaattaacctagatttgtaatattccctcgattgagaacactgt |
41979354 |
T |
 |
| Q |
201 |
gaacatcnnnnnnncaaacgatcatctatggtactttcat |
240 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
41979353 |
gaacatctttttttcaaacgatcatctatggtactttcat |
41979314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 88
Target Start/End: Original strand, 22085551 - 22085618
Alignment:
| Q |
21 |
agtcaaggcttgaaagggaacataagtgaccaaattagtcttttgtcagacttggtaaccctgtaagt |
88 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
22085551 |
agtcaaggtttgaaagggttcataagtgaccagattagtcttttgtcggacttggtaagcctgtaagt |
22085618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University