View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3226_low_38 (Length: 250)
Name: NF3226_low_38
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3226_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 42397217 - 42397427
Alignment:
| Q |
1 |
atagtatgaacatagactttatttttgggtactagatgaacatagactctgttacttatacgagtattacgggaagaagcaatgtcacacaccttttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42397217 |
atagtatgaacatagactttatttttgggtactaaatgaacatagactctgttacttatacgagtattacgggaagaagcaatgtcacacaccttttaga |
42397316 |
T |
 |
| Q |
101 |
aacagttgaaaggagagtaattagaggctcaaatatctccttttataggatcataataatttaccatctttacaaaaaatagnnnnnnnngactaaatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42397317 |
aacagttgaaaggagagtaattagaggctcaaatatctccttttataggatcataataatttaccatctttacaaaaaatag-tttttttgactaaatcc |
42397415 |
T |
 |
| Q |
201 |
aacttaacgcta |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42397416 |
aacttaacgcta |
42397427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University