View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3226_low_38 (Length: 250)

Name: NF3226_low_38
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3226_low_38
NF3226_low_38
[»] chr8 (1 HSPs)
chr8 (1-212)||(42397217-42397427)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 42397217 - 42397427
Alignment:
1 atagtatgaacatagactttatttttgggtactagatgaacatagactctgttacttatacgagtattacgggaagaagcaatgtcacacaccttttaga 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42397217 atagtatgaacatagactttatttttgggtactaaatgaacatagactctgttacttatacgagtattacgggaagaagcaatgtcacacaccttttaga 42397316  T
101 aacagttgaaaggagagtaattagaggctcaaatatctccttttataggatcataataatttaccatctttacaaaaaatagnnnnnnnngactaaatcc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||    
42397317 aacagttgaaaggagagtaattagaggctcaaatatctccttttataggatcataataatttaccatctttacaaaaaatag-tttttttgactaaatcc 42397415  T
201 aacttaacgcta 212  Q
    ||||||||||||    
42397416 aacttaacgcta 42397427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University