View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3226_low_55 (Length: 203)

Name: NF3226_low_55
Description: NF3226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3226_low_55
NF3226_low_55
[»] chr8 (2 HSPs)
chr8 (70-143)||(42396982-42397055)
chr8 (127-185)||(42397067-42397125)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 70 - 143
Target Start/End: Original strand, 42396982 - 42397055
Alignment:
70 ttggatctcttgatcttatttagaattgccaaatgttttttatcaaaagataaaatgaattgctaagtattgtt 143  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||    
42396982 ttggatctcttgatcttatttagaattgccaaatattttttatcaaaagacaaaaagaattgctaagtattgtt 42397055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 127 - 185
Target Start/End: Original strand, 42397067 - 42397125
Alignment:
127 aattgctaagtattgttgtctgttgatatttatttgaatagttcttcccattgaatatt 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42397067 aattgctaagtattgttgtctgttgatatttatttgaatagttcttcccattgaatatt 42397125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University